Plasmids and primers | Characteristics | Source |
---|---|---|
Plasmids | ||
pCas | Kanamycin resistance Temperature sensitive: cultured at 30 °C, Size: 12,545 bp | [22], Addgene plasmid #62,226 |
pTargetF | Spectinomycin resistance, Size: 2117Â bp | [22], Addgene plasmid #62,226 |
pTargetF-OmpF | Modified pTargetF; 20Â bp change of gRNA | This study |
pUC57-ompF-MPER | Plasmid vector containing MPER surrounded with 300Â bp (from each side) homologous to ompF sequences. | GenScript |
Primers | ||
pTF_ompF107-F | CGCGTCGTTTTAGAGCTAGAAATAGC (Tm1 = 66.5oC) Insertion of gRNA into pTargetF | This study |
pTF_ompF107-R | TTTTGTTACCAGTTACTAGTATTATACCTAGGACTGAGTC (Tm1 = 66.5oC) Insertion of gRNA into pTargetF | This study |
118 F Pre-OmpF forward primer) | GTAGCACTTTCACGGTAGCG (Tm1 = 60 ºC) Binds to the plus strand upstream of ompF | This study |
105R2 (OmpF reverse primer) | GTAGCTGATAGAACCGCCAACAC (Tm1 = 60 ºC) Binds to the minus strand of ompF, downstream the insertion | This study |
108 F (pTargetF forward primer) | TTTCCTGCGTTATCCCCTGA (Tm1 = 60ºC) Binds to the plus strand of pTargetF, upstream the sgRNA | This study |
108R (pTargetF reverse primer) | CGACGCGTTTTGTTACCAGT (Tm1 = 60 ºC) Binds to the minus strand of pTargetF-OmpF and is specific for the OmpF-gRNA | This study |
109 F (OmpF forward primer) | AACAGTTACGGTGGCAATGG (Tm1 = 60 ºC) Binds to the plus strand of ompF, upstream the insertion | This study |
109R (MPER reverse primer) | CCAAAGACTTGCCCACTTGT (Tm1 = 60 ºC) Binds to the minus stand of MPER | This study |